cdaA [2018-07-17 19:15:09]

diadenylate cyclase, synthesis of c-di-AMP in vegetative cells

Locus: BSU01750

Isoelectric point: 8.07

Molecular weight: 30.42 kDa

Protein length: 273 aa

Gene length: 819 bp

Function: synthesis of c-di-AMP

Product: diadenylate cyclase

Essential: no

E.C.: 2.7.7.85

Synonyms: ybbP,ybbQ

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides
• Groups of genes → Membrane proteins

Gene

Coordinates: 196,213 → 197,034

Phenotypes of a mutant

• inactivation of cdaA results in severe beta-lactam sensitivity PubMed
• a cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-AMP from two molecules of ATP PubMed

Paralogous protein(s)

• CdaS

Domains

• contains a DAC domain involved in the synthesis of c-di-AMP PubMed

Effectors of protein activity

• the interaction with CdaR stimulates the diadenylate cyclase activity of CdaA PubMed

Structure

• 4RV7 (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273), 65% identity) PubMed

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: cdaA-cdaR-glmM-glmS
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

Additional information

• CdaA levels are increased at increased potassium concentrations PubMed

Biological materials

Mutant

• GP94 (DcdaA::spc), available in Jörg Stülke's lab PubMed
• GP997 (cdaA::cat), available in Jörg Stülke's lab PubMed
• GP985 (cdaA-cdaR::cat), available in Jörg Stülke's lab
• GP2222 (cdaA::cat cdaS::ermC disA::tet), available in Jörg Stülke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMed
• BKE01750 (ΔcdaA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
• BKK01750 (ΔcdaA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

Expression vector

• expression of native cdaA in B. subtilis: pGP1960 (in pBQ200), available in Jörg Stülke's lab
• expression of cdaA-Strep in B. subtilis suitable for SPINE: pGP1986 (in pGP382), available in Jörg Stülke's lab
• IPTG inducible expression of cdaA-Strep in E. coli: pGP2564 (in pGP574), available in Jörg Stülke's lab

LacZ fusion

• GP1339 (cat) based on pAC6, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab. Respective plasmid: pGP1990.

FLAG-tag construct

• GP1381 cdaA-3xFLAG ermC (based on pGP1087), available in Jörg Stülke's lab PubMed

References

Reviews

Loading

Original publications

Loading